You are here:

Biology/College Biology

Advertisement


Question
For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand.

DNA 3'--ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC--5'

Answer
Hi Danielle
I will start the sequence for you and you can finish. Then I will see if you did it correctly. This is my policy with homework questions. Remember the base pairing rule.
 A-T
 T-A
G-C
C-G

   ATTGCTTACTTGCATGGTACCTCTAGCGTTTAGGC
   TAACGAAT
      now you finish

Biology

All Answers


Answers by Expert:


Ask Experts

Volunteer


Walter Hintz

Expertise

Science teacher for over 50 years. MSc. in biology. I can answer questions in general biology, zoology, botany, anatomy and physiology and biochemistry.

Experience

I have a MSc in biology and have been a science teacher for over 50 years. At present I am a faculty member at a college and a science consultant at seven catholic schools.

Publications
The Ohio journal of Science
Momentum-The Journal of the Catholic Education Association

©2016 About.com. All rights reserved.