AboutWalter Hintz Expertise Science teacher for over 50 years. MSc. in biology. I can answer questions in general biology, zoology, botany, anatomy and physiology and biochemistry.
Experience I have a MSc in biology and have been a science teacher for over 50 years. At present I am a faculty member at a college and a science consultant at seven catholic schools.
Publications The Ohio journal of Science
Momentum-The Journal of the Catholic Education Association
Ehall wrote at 2006-07-30 00:41:31
http://www.thinkbiotech.com/DNA-o-gram/decode.php
Use the DNA-o-gram to get the name of the protein by cut and pasting AAGATTAGTAGTACGACAATC into the "ENTER YOUR DNA CODE" This will answer the question "What does my conclusion mean in terms of determing the name of the protein?"
